Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19k22
Contig Information
Length 662 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19k22   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194707512|gb|ACF87840.1| unknown [Zea mays]
Score 924
Evalue 4.85492e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok19k22
GAGGCCGTATCCGNTCGCCGTGCAGCGCGGGCGGGCAAATGGGAGTTGGGCGGNGATGGGCGCGGCGAGCTCGAGGCTGGAGAAGGCGCTGGGCGAGCAG
TTCCCCGAGGGCGAGCGCTACTTCGGCCTCGAGAACTTCGGCAACACCTGCTACTGCAACAGCGTCCTCCAGGCACTTTACTTCTGTGTTTCTTTTCGCG
AGCAATTACTGCAGTACTATGCAAACAATAAAAGCGCCAGTGATGGCGAAGAGAACATGTTAACCTGCTTAGCTGACCTTTTCTCTCANATCAGCAATCA
GAAGAAGAAAACGGGTGTTATTGCTCCAAAGCGTTTTATACAACGATTGAAGAAACAGAATGAGCTTTTCCGCAGCTATATGCATCAGGATGCTCATGAA
TTTCTGAATTTTTTGTTGAATGAGCTAGTTGACATTCTCGAGAAAGAATGTAAAGCCAATAAAGAAACTCCTCAAAATTCATCTTCAAATAAGAGTTCTA
ATGGCCCTATTAATGGTCAGCCCAATGGTAGTCATAAAGAACCAGAGACTACATGGGTCCACAAATGCTTCCAGGGAATATTGACTAATCAAACAAAATG
TCTGAGATGTGAAACCGTCACTGATAGAGATGAAACATTTCTTGACTTGAGCCTGGATATAG
page-top