Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19k09
Contig Information
Length 771 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19k09   
Homology (BLAST) Top Hit hypothetical protein OsI_23153 [Oryza sativa Indica Group]
Score 1307
Evalue 2.59053e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok19k09
AATGCTATTCAAGCAACAAACGCATGGTTGAAGGAAGGGTTAAAGCAACGCTGTATCACCAGAGATCTTAAATGGGGAGTTCCTGTTCCACATGAGAAGT
ATAAAGACAAGGTGTTTTATGTCTGGTTTGATGCACCAATTGGGTACATATCTATCACAGCATCATATACGCCTGATTGGGAGAAGTGGTGGAAGGATCC
TGATAATGTAGAGTTGTTCCAGTTCATGGGTAAAGATAATGTGCCATTTCACACGGTCATGTTCCCTTCAACACTACTGGGAACTGGTGAAAACTGGACA
ATGATGAAGACCATAAGTGTTACTGAATATTTGAACTATGAAGCAGGAAAATTTTCCAAGAGTCATGGTATTGGTGTCTTTGGCAATGATGCGAAGACTA
CTAATATTCCGTCTGAAGTATGGCGATACTACCTGCTTATGAACCGCCCTGAGGTATCAGATACACTGTTCACTTGGGCTGATTTACAAGCTAAATTGAA
CAGTGAGTTGCTGAACAACCTAGGAAACTTCATCAACCGTGTGCTAAGCTTTGTTGCCAAACCAGCTGGAGGCGGATACGACTCCATCATACCTGATGCT
CCTAATGCGGAGTCACATCCATTGACCAATGCACTTGCTGAAAAAACTAATAAATGGGTTGAACAATATCTTGAAGCAATGGAGAAGGTTAAACTGAAAC
AAGGACTGAAGAGTGCGATGGCGATTTCTAGTGATGGAAATGCATATTTGCAAGGAGAGCCAGTTTTGGAG
page-top