Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok18g16
Contig Information
Length 740 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok18g16   
Homology (BLAST) Top Hit GTP cyclohydrolase 1 isoform TaA [Triticum aestivum]
Score 1203
Evalue 2.74604e-130
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok18g16
GGTGTTGACAAAAGGACTGGTTCTGCTGGAGGAACTGGAGGGCAAGTTGTTGTTCGTGATATCGATCTTTATTCATACTGTGAGTCTTGCTTACTTCCGT
TCAGCATACAATGCCATGTTGGATATGTGCCCTCCGGTGGAAGGGTCGTTGGGTTAAGCAAGCTTTCAAGAGTAGCTGATGTCTTTGCCAAGAGATTTCA
AAACCCTCAGAGATTAGCTAATGAAGTTTGTGGTGCATTGCATGTTAGCATACAACCTGCTGGTGTTGCTGTTGCTATGCAGTGCTGGCACATACCGTTG
CCGGAGAACTTCAAATGCAAAAATTCGCGAGCTTTGATTAGAACCTCACATTCATCTCGTTCGGGAGTTTTTGAGGGCGAGAACAGCTCCTTTTGGAATG
ATTTTGTGGCTCTTCTTAAGCTTAGAGGCATAGACATGGAGATGGACAGCCGTTCTGCTTCTTTAACTTGGTGCCCCTTAAGGCCTCATGAGGTTCCGCT
TTGCAATGGGCACGCAAAGAAGATTACAACCAATGGTGCTAGCTCAGCAAAATCGGCATCCATTCCATCTAATATGGTTTCTGCTGTCAGCTCAATGCTC
CTGTCTCTTGGTGAGGACCCCCTAAGGAAAGAACTTCTAGGCAGTCCTCANCGTTACGTGCAATGGCTGATGAGGTTCANAGCATGCAATCTTGATGTGA
AGCTGAATGGTTTTACACTTAACAGTGCAAGTGTATATGA
page-top