Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10j22
Contig Information
Length 813 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10j22   
Homology (BLAST) Top Hit PREDICTED: hypothetical protein isoform 1 [Gallus gallus]
Score 79
Evalue 7.01269
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whok10j22
GTCACGACCATTTCAAGAGCTTGTTCTCTAACTTTGTATGCAAATGTCAAGGAAAAAAAGTCCCTGTTGTGGTGTGTGCATTATGATTATCCTTATACAG
CGGTTCAGTTGGATAGTTGTTCAAGACTATTATGCCTGAAGTTTTTATATATTTGTATATTTTGATATAATCTGATCTGCCAAGAAAATAGATAACTATG
AAAATTATGGTCATTGGATGATCTGGTTAATTGCCATTCAATGACATGAGATCGACAGATATATTGATGTTTCCTTGATGTCCACTTTTAATGAGCTCAT
AATAATTATTTTTTTGGCCTTGTTTTAGTTCAGCCGTGCATTGCGCATTGCATTTGAGGTTATTAATTATTTGGGATGAACCTACAATTTCTTTTCATGT
CATTTCTTGATGATTAGTCCCATTGACACAAATAGTTCCCGAATGTTAATAATGGCCACTTGGGAATTCCAATGTCTGTTTTTACATGTATGCATCTAAT
TTTGAAGTCCTTTCATGCATATTCAGCATGTTTCTGCCGCGCTCCTCATCTCACCAGTTGCCTCGGTAAGATGTTGTGCTCTTATAGAATTTAGAGCAGC
GGCCTTTTAGAACGAATACTGCATAACATAGTGTTGTCCAGTGGAATGTGGAATTTTTTTGTTTGATTTATTTACTATCCTTTGTGCTAATTTACATATC
TTANATTCCTTTGCTTTGTTTCAGCAGCAGAATATACAAGATAGGAAAATACTTCTAAGCTTTTTGTGAAAATTCTGATCCNCTGGTGAATTTTTTCTTT
TCTTAAAAAGTTA
page-top