Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19j19
Contig Information
Length 798 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19j19   
Homology (BLAST) Top Hit hypothetical protein OsI_00588 [Oryza sativa Indica Group]
Score 1115
Evalue 5.05827e-120
Total Hit Count 280
Registered year 2003
Contig Sequence     [ Download ]
>whok19j19
CGGTGGTGGTGGTGGCAGGCGACTGTGACTAGCAGGAGCGCGGAGGAGGGGTCCTTCGGTTGCCGCCATGGCTCAGATCTTGCTCCATGGAAACCTCCAC
GTCACCATCTTCGAGGCCTCGTCGCTCTCCCACCCCGGCCGCGCCAGCGGCGGCGCCCCCAAGTTCATCCGCAAGTTTGTGGAGGGGATTGAGGAAACCG
TTGGTGTTGGCAAAGGCAGCTCCAAGCTATATGCCACCATTGATCTCGAGAAAGCTCGTGTTGGGCGTACCAGGATGTTGGGCAATGAGCCTGTCAACCC
TCGCTGGTACGAGTCGTTCCACATCTACTGTGCGCACCTTGCCGCCGATGTGATCTTCACTATGAAGGCCGACAACGCGATCGGGGCCACGCTCATTGGA
AGGGCGTACCTGCCTGTCGCAGAGCTCCTGGAAGGAGAGGAGATCGACAGGTGGCTTGAAATCTGTGATGACAAACGGGAGCCTGTTGGTGAGAGCAAGA
TCCATGTGAAGCTTCAGTACTTTGGCGTTGACAAGGACCGCAACTGGGCGAGGGGTGTCCGGAGTGTCAAGTTTCCTGGTGTTCCTTACACCTTCTTTTC
NCAGAGGCAAGGATGCAATGTTAGATTGTACCAAGATGCTCATGTCCCANACAACTTTATCCCCAAGATCCCGCTCGCGGATGGCAAGAACTATGAGCCT
GCCAGATGTTGGGAGGATATCTTTGATGCCATAAGCAATGCTCANCATTTGATTTACATCACTGGTTGGTCTGTGCACACTGANATCACCTTGATTAG
page-top