Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok6a02
Contig Information
Length 856 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok6a02   
Homology (BLAST) Top Hit Os01g0231500 [Oryza sativa (japonica cultivar-group)] >gi|56783874|dbj|BAD81286.1| putative dual specificity kinase 1 [Oryza sativa Japonica Group] >gi|113532027|dbj|BAF04410.1| Os01g0231500 [Oryza sativa (japonica cultivar-group)] >gi|215767098|dbj|BAG99326.1| unnamed protein product [Oryza sativa Japonica Group]
Score 372
Evalue 8.236e-34
Total Hit Count 101
Registered year 2003
Contig Sequence     [ Download ]
>rwhok6a02
TACCTTATCACCACATGNTCTATTGGATAGTTACCAGATGCTGAATGACCCGACAACATCACTATTGCTCAATGTCCATGCCATTTATCTAACCATATGA
ACTATGTACACCCAACATCATCACTATTGCATAATGTCCATGCCATTTATCTGACATATGAACTACTTACATGTCCTCCGCAACTGTGACAACAAAATGT
CTGAAGTAAGAGTGACAGAAACTGCTGGAGCATCCAACGCAGCAGTGATCAAAACCTTGCATAATCAATCGGATCTGTAGCCATCTTTGTAACATGCATT
AGGCATCAAGATGTTTCAATTGATTTTGTGATTCTTGAATCTGACCACTCTAAAAGAAATGGAGTCTAGTTGAGCATTTCCACATTTCTAGCTCCACAAG
AGAGGTGACCTATCACCTTGCTGGGGCATTGTGCGGAAGTGTCGGAAAACAAGCGCTAGGAGAGCCAGTATTGCTGTCAAAACCCTGATTTTGATGAAAA
GCGTCAATACGCACTATATGTCTTGAATTCCCATCATTCTTCGGGTTTTCATTTCTGGCACTGGCAGCCATATTTTGCCTCTGTAACTGTGCAGCTGACC
CGGTCATATGGCTTGACTCCATCTGTTCATGGGCTTCATTTGGATGGACATCCCCATTTACACCCGCTCGTTTGTCAAGATGTGTTGGGATTGCTCGAGT
AATAGTTGCCCCAGGAACATGCTGGGTCTTTTGGCCTTGTTTATATTTCAAAACAGTCCAGTCAAAGACATAATCAAAATCATAAACCTTGGCGGTCGAA
TAAGTCTCGAAAAAAAGGCGCTTCACGAAATCCCATAATCANGGCCGCTGATCAAA
page-top