Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20i03
Contig Information
Length 794 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20i03   
Homology (BLAST) Top Hit hypothetical protein OsI_07663 [Oryza sativa Indica Group]
Score 979
Evalue 2.95682e-104
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20i03
ATTGATGCAACAGCTGCAAGGTTAAATGTCATAATTACTGGAGAACCGATATGTGATTAATACAACATTGCTACAGCATCATACAGTTAGTGAGGCACCA
TTATCTTCCAGTGAAAGGCTTAGAATCATTGTGGCTGCCTTGGGTGCCCATTGCTCAGTAGATTGGTATAACGCAGCTGAACTTCCAAAGCATGAAGTAA
GCATGTCGGTATTCACAACACCAGGGCTAAGAGCAATTGCTGCCAATCCAGGAGGCAACTCCTTTGCTAATGAGCGTGTTAAACCTTCAATAGCCCACTT
TGAAGCACAATATGGTGCAACCTCTGCAGCAGCAGACCTTCCCCAACCAGAGGATAAATTGATTATCATCCCATGTTTCTTCTGTATCATAAGTGGTACA
AAATGGCGAAGTACATTTGCTGTTCCTTTAATATTTGTATCAACCACCGTATCAAATTCTTCTGCTGGAACATTCCACGTTTTGTTATTCTTGTTTATTG
TACCAGCATTGTTTACTATGATATCAGGAATTTGCTTCCTTTCCACAACAGCCTTTGCCAATTCACCCATGCTGCTGTCAGACCTGACGTCAGCGACGGT
GAGAAAGTGGCGAGACGGGGAACCCATCTCGGCCTCGAGGGAGCGGATGGGATCGGCGGAGCGGCCGCAGCCGACGACGGCGTGCCCCCGGCGCGCGAGC
TCCAGAGCTAAAGCTCGGCCCAGCCCCCGGCTGACCCCCGTGATGAGCACCGTCCTCGGCCCCGCTCTCTCTCTCTCTCTCTCTCTCTCTNNCT
page-top