Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok18j17
Contig Information
Length 724 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok18j17   
Homology (BLAST) Top Hit hypothetical protein OsJ_033748 [Oryza sativa (japonica cultivar-group)]
Score 169
Evalue 2.08235e-10
Total Hit Count 97
Registered year 2003
Contig Sequence     [ Download ]
>whok18j17
TCGCTGCGTGCCTGCCTGCTTCCTCCACCCGACCCTAACCCTAGCCGCGCCGCCACCATCGATCCCCAAATCCCTCCCCCCTCCGCCCTCCACCCAACCC
TAATCCCTACCTACCTTAGCTAGCTAGCCGCCATGGGCCGTTCCATGGCTCTGCTCCACCGCGAGATTTACTTCTCCGACGACGAGGCGTTATCCGGCCG
AGTGTCGTCAATCCGCTGCCCGTGGGAAGGACGAGATGGTCCACCAAGCCGCCAAGAGATCAGTGACGCAGTCACCGGTTACCTGCGGACCTTCAAGGCG
CACGCAGTCGTCGCCGATCCGCCGGCGCTCTCCTTCCTCCACATACTGCGGCCGCCGGTATCCGTCGGGCTCCCGGTGCAGCTCCACAGCCTCACCATGG
CCACTCTCTCCAGCGCGGACAAGAACCTGGTCGCCATGTACGCCGGAGCGTACCGCCCTGGCAACCGTTTCCCTGGAGGCTACCTCATCTACGACGCCAG
GAACGACTCCATCTCTGGGATCCCCGAGCTCCCCTCCGACCACTCACATAGAGCCATCGGGTGCGAGTCGGCCGTCGTCATGTGCGCCGCCGGGAACGAC
TACTTTCTTGCCGAGCTCGTCAGGGTCTGGCCAGATGGCTCCCAAGCTGCGCTCTGGCTGTGGAAGTCGTCCGTCCAAAAATGGGACTTGCATCCCAGTC
GCCTGCCCCTTCCNATCCAGCACC
page-top