Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok6m01
Contig Information
Length 794 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok6m01   
Homology (BLAST) Top Hit hypothetical protein OsI_10152 [Oryza sativa Indica Group]
Score 1190
Evalue 1.0092e-128
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok6m01
GTGATGTGCAAGCAGGAAGATGCACCAGATCCAGTGATAAACGCATGCAATGGTTTCTACTGTGATGCATTTACACCGAACACGCCTTCAAAGCCTACGA
TGTGGACTGAAGCTTGGACTGGTTGGTTTACCGAATTTGGTGGGACCATCCGTAAACGACCAGCTGAAGATCTTTCATTTGCTGTTGCTCGCTTCGTGCA
GAAGGGTGGTTCTTTTATCAACTACTACATGTATCATGGTGGAACAAATTTTGGGCGCACCGCTGGAGGTCCCTTCATCACCACAAGCTATGATTATGAC
GCTCCACTTGATGAATATGGACTTGCAAGAGAACCAAAGTATGGACATCTTAAAGAACTTCATAGAGCTATTAAGTTATGTGAGCCGGCCTTGGTTTCTG
TTGATCCAACTGTGACTTCCCTTGGAAGCATGCAAGAGGCCCATGTCTACCGATCTCCATCTGGTTGTGCAGCTTTTCTCGCAAACTATAATTCTAACTC
TCATGCAAAAGTTGTCTTCGACAATGAGCATTATAGTCTTCCACCTTGGTCAATCAGCATCCTTCCTGATTGCAAAACAGTTGTTTATAACACTGCAACG
GTTGGTGTTCAGACATCTCAAATGCAAATGTGGTCCGATGGGGCCTCTTCAATGATGTGGGAGAGGTATGATGAGGAGGTTGGTTCACTGGCAGCTGCTC
CGTTGCTCACCACAACTGGTCTACTGGAACANCTTAACGTCACAAGANACACCANTGATTATCTTTGGTACATGACCANTGTGGATGTAANCCC
page-top