Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19f22
Contig Information
Length 147 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19f22   
Homology (BLAST) Top Hit gigantea 3 [Triticum aestivum] (no hit)
Score 1306
Evalue 3.69066e-142
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whok19f22
TTTACTCTGTATCTGAACTTGTTTTGGTCTGCNGAACCGTACTGCTATGATGAATGTGTCNATGATGTAAATCGTGGCTGTCGTGCCTGTCTGACTGATA
CATTGTTATCGTACTCGATAAATGATATCATCTGTGCAAAAAAAAAA
page-top