Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20i04
Contig Information
Length 493 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20i04   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195625292|gb|ACG34476.1| hypothetical protein [Zea mays]
Score 651
Evalue 1.00497e-66
Total Hit Count 106
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20i04
ACGCACGAAAACATCCCTGCCGTAGCCAACGACGTAGAAGCTAAAAGATCGCTTACGGTGCGACATAGTGACATGGGTTACGGGCACGACCGAGATGATG
TGTCTCTCCGAAATGACAATTGCGGATGGTGGAACTGGCAGCCGGCTAGCAACAACCTCCGAGGACAACTGGTTGAGTGGGTATGAATCGGCAAAGAAAG
CAGGAGTGCATTGGTATGCCTGTATGTTGCATANTTGCGCCCCTTGCGCTCTGTGGAAAACTTCGTCAGGGACCGCAGCAGTTTCTGCTGTTGCACTAAC
TTTTCTCGCTGTAAGCGTCTCCCATCGAACGCGAGCAATGCTTTGTGTAANAAGGGAACCGCAGCCATTACATGTCCGGCATGTTACTATGCCACGGGAT
CCACATTCTGTGCANGGCAACACTCCTTGACCATTGCACATCCAACATACTGAATCANATTCNTCTTGCTGANCGAGTGAACCCCTGCCCTGA
page-top