Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok18k09
Contig Information
Length 799 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok18k09   
Homology (BLAST) Top Hit hypothetical protein OsI_01366 [Oryza sativa Indica Group]
Score 1189
Evalue 1.33803e-128
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok18k09
CCGTGGCATTGAGCTGAGGTACTCTGGTGATTTCCCTTGTATAAATGTTGGGAAACCTAGGCGGCCAACATATTTTCCCATTGAGCTCTGCCAGCTGGTC
CCTTTACAAAGGTATACCAAATCTTTGAGTACCCTACAAAGATCATCTCTTGTTGAGAAGTCCAGGCAGAAGCCTCAAGAGAGGATGTCAGTTTTGTCTG
ATGTACTGAAACGCAGCAGCTATGATACAGAACCCATGTTGAAGGCATGTGGAATTTCGATAGCTCAGGGCTTTACACAGGTGGCTGGTAGGGTACTGCA
GGCCCCCAAGCTCAAAGCTGGAAATGGTGAAGATATTTTCACAAGGAATGGACGTTGGAATTTCAACAACAAGAGGCTTGCTAGAGCTTGTGTGGTGGAC
AGATGGGCAGTTGTAAACTTTTCGGCTAGGTGTAACACCATGAACCTTGTCAATGACCTCATCAAGTGTGGGGGCATGAAGGGCATTACAGTAGAAAAAC
CTCATATTGTAATTGAAGAGAATGGTTCAATGAGACGTGCACCTGCTCCAAAAAGGGTTGAGGATATGTTTGAGCAAGTGAAGTCTAAGCTTCCTGGGGC
TCCGAAGTTTCTCTTGTGTATTCTTGCTGAGAGGAAGAACTCAGATGTTTATGGTCCATGGAAGCGAAAATGCCTTGCTGACTTTGGGATTGTCACTCAA
TGTGTGGCCCCAACAAGGGTCAATGACCAATATCTGACAAATGTTCTGCTGAAGATCAATGCAAAACTTGGTGGAATGAACTCACTACTACAAATTGAA
page-top