Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20i09
Contig Information
Length 463 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20i09   
Homology (BLAST) Top Hit hypothetical protein OsI_03373 [Oryza sativa Indica Group]
Score 214
Evalue 5.66943e-29
Total Hit Count 171
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20i09
AACATTTAGACNTATCCAGACAAAGTCAANGAGGTACTTGACAAACCTCTGGAAGCCTATACCAACATGGATTTTCCTCGCCTAGTTTTGGGAGTTATCC
ATAATATCATCAAGAATGAGGAAATAAGCCTGAAGCTGCACATTACCCCGAAGAACAAGCATGAGAATTACACCTGGTTGCATAATACTCAAATCACGAA
ATGACCGAAGCACCGATGGTGATAGTAATACCCATTCAATGCCCCANCCAAGAATGCAAGCAAGGAACTCTTCCTCCTCGCTCGGTTCAAATCCTGCTTT
CAACAATTTGTAGCTCAGCAGCCAAGCCGCGGTTGAGCTTTCCACCAAGCACGTTGTAGTCCAACATGGCGTCGATCCATCGGAGGGCGTCGTCGTTGAA
GTCGAAGGAGTCGTCCCGGAGAAGCTCGGCCTCGAGGGTCTCGTACACGCGCCGGAACGTCGC
page-top