Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20j04
Contig Information
Length 834 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20j04   
Homology (BLAST) Top Hit auxin amidohydrolase [Triticum aestivum]
Score 823
Evalue 4.12418e-92
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20j04
GTCTGACCCCACTCTTAACAACCCAATACATCCATCATCCATGAGGTGTTTTATTTTGTCTCAGCACTGCACTCAAAGATTACACGTAGACCCGGCTAAG
CGCAGATGCGAAAACGAACGAGACCTACCACAGAAACACATATTCGCAGTGCTTCAATGCCGTCACAAGGTCATCTGCTCGCTTGGAATGCGCTGAAATC
AGGAAATTATGTACAAACAGTTGCATAATCACCTGGCGATAGGTCCTCGTCCAACAAGTCAGCTTCATTTGGCACAGAGCCTTACCTCCCCCCATCTACA
GCTCGTCACGAGGTTCCACCTTAGCAGCGGTAGCGGGCTGGTGCTCAAGCAGATAGCGAGCAGCCAATGATGCTTGCATGGCTGCACCATAGGGCAGTGC
ATCCTCGTTGATGGTGAAGTAGGGGGAGTGATGAGGCGCCTGCGGTCCACGAGTCTCATTGAGCATCCCCACGAAGTAGTAGTATGTCTTGGGAACGGCC
TCGGTGTAGAAGGAGAAGTCCTCGGCACCCATCAGTGGCTGCTTCTCTCTCACGTTGTTGGGGCCAACCATCTCACTGCCCACCTTCGCAAAGAAATCGT
GAAGCTCGGGATTGTTGATTGTTGGAGGGAAGAAAGGCTTATCTTTGTCAAGGAAGTCCACAACTGCACTGCAGCGCTGGACAGATGCCTGTGTGACTAT
GACCTCTTCAATTCGCTGCTTCAATTGATTAAAACTCTCCTTCAAAAAGGCTCGGAAGGTACCACCTATTGTCACGGGAATCAGGGATAACATTGAAGGC
TCCACCACCTTGAAACTTTCCAACCGTTACTACC
page-top