Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10i15
Contig Information
Length 842 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10i15   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194708316|gb|ACF88242.1| unknown [Zea mays]
Score 513
Evalue 3.55882e-50
Total Hit Count 214
Registered year 2003
Contig Sequence     [ Download ]
>whok10i15
AACGCGCATGTTGTGGATTTGGGTGCTGCTCCAGCCTCGAGAGACCAAAGTCGGAGTAGGCGCTAGATAGAAGACCTGCACGAACTCATACCGTCTACGC
AATCTTCTGAAGAAAGAAAAAAAACGAAACGTCGGCGCAACGGACAACCGACTTCGACTCGGAGACAGCAATCATGCTGTAATTTCAAGACGAACTTCTT
AAAATCGAGCAGGAGCAATCGCCGAATCACGCCCGCTGTCTCAGTCCGACCACTCTCCGTTCCTCGATTTCGCAAGGTCAACATGCGCACGATGGGTTTG
GGATTGGGAGCGCCGTTCTTCTTCCTCTTCCTCCTCTTGCTGGCCGCCGGCTCTGGAGCTATGCCGCAGGACAAGAGGGTTCGCAAGAATTACGGTCTTC
TCCTTCTGGATACCATTGAGTTCCACCCAAATGACAAGGAGGAAATTACCTCTAGCAAAATTCCTGCCTCGGTTGAGAGTGGTAACCCAGTATGCTCAAC
TTGTGAGAACTTGACAAATAAAGCTGTCAGTTATCTTAGTGAGAAACAGACACAAGATGAGATCATGGAGATCCTTCATGGTGCGTGTTCTCAGACATTC
TCCTTAGAACAGAAGTGTCTTGAGATGGTGGACTCCTATGCAACTCTTCTCTTTGCCAAGATCACTGAAATCAAGCCAGACGAGTTCTGCAAACAGTATG
GCCTCTGCAGGGAAGTATCGTTTCTGTCTGTTGAGAAAAGTGAAAGCACTTGTGCATTTTCCCACCACCTCGTCGATGAAGTTCTCTCGAAAATGAAAGA
CCCTGACGCGCAGTTTGAGATACTTCAACTTCTCATCAAGGA
page-top