Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok5m12
Contig Information
Length 886 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok5m12   
Homology (BLAST) Top Hit hypothetical protein OsI_36069 [Oryza sativa Indica Group]
Score 424
Evalue 2.45867e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok5m12
ATCACTTAACAAAACGGTGTAACCTAATGGACCCCTTTTATTTCTCTTCTAGGCAGAACTAGAAAGATGAAAATGGCAAGCAAACCTACGCTCTGTCCAA
GCTATATAGCCGCAGCAATATCCACCTAGTTAACCATTCCCTATGTTCTCATCATTCCCCATCTGTATTGATACAGCCAACTTCTAATGGTATTCCTCGC
ACCTTTTCCGTCCAAGCTGTATAGCCGCAATATCCTATGGTCTCACACCGAAACCTTGCAATTCCACACACAAAAAAGGACCCAAAAGGGTTCTTCTAAA
CTTGCGAAGCTATGCAACAACTCAGATTATCTTTGGCTAGATCTGCGGCTTCGTTTCACACATGACTGGGTTCCATTGCTTGCTGCTCCATCTGCTTCTC
CAACTCTTCTGTAGAACAGCACGTAAGCTGCACCTGACTTCACTTCTTCCTCATTGATGGCAGAAACATGGCTATCATCAAAATTGTACCACCTGTTCTC
ATCCAAGAGCTTTATGTAAGCAGTATAATGCCCACTCGCCATGCTGCCATAATGATTGCTAACAGCATACAGCTCATAAGTTTGACGCTGAGGTATTAAA
TGAAAATCTCTTCAAATGAATAACTAACACTTCTGGTAGTCTCCATAAATCAAGCTTTTTACTAGCTTGCCTTTGCTCCTTGCACCTCGGACAGTACCAC
ATTTCTTCAGGAACAAGTGGTTCTTCTCTCAAGAAAGCATCCAAGCATGCATAGAGTGAGAGAGGTTCACCACGGGTTCTCTTGGCGGGAGGAGCATACT
TAAACACCTCTGGAAGGTGCTCCAAATGGTTAGTGGTTCAACTTTTTAAGATCTAACTTGGAACCAGNTGACAAAAATAACAGTTG
page-top