Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok5n05
Contig Information
Length 823 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok5n05   
Homology (BLAST) Top Hit hypothetical protein OsI_13176 [Oryza sativa Indica Group]
Score 579
Evalue 7.587e-58
Total Hit Count 486
Registered year 2003
Contig Sequence     [ Download ]
>rwhok5n05
ATATGTTCACTCTTTACAACAAAAACAACAACAAGAAAACAAAAATACCCATTACTGCTATGTACTGTTCATGGCCTCTCTATTTTAGTCTTGCTCAGGG
AAAACCCTCTCGAGGAAACTAACGAATCGTTTCGAATACAAGTTCGGATCAACAGATGATATAGAAAGCGGGTCGAACTTGAGCGATTTGACCGCATGCT
CCACCCTCTTGGACGTGTTGTACTCCTGCAGTATGTCTATGATGCCGAGGTAGAGCACGACGTCGTACTCCTCGACCGCGTCCGTGCTTTCCAGCAATTT
CCGAGCTCGGGCTGGCATGTTCACCCCTAGCTGCACACGGAATCTGCCGGTGCCTGGCAGAACAAGATCGACTTCTTCGTAACCACCTTCTGATGCTCTA
ACCATGCTTCCTCTGATGTGGGAACCGCCTACTGTTGTACCTGGCTCGTGAGCAACTAGAAGAAATCCCTTCGAGGAATTCACATCCTCACAATGCAGTG
GCACGCTACCTGATTAAGGTGAAAAAGACAATAGATGCAAGTCAAAACCTGAAGATGGGCAATTGATACCAATTGGATGAAACTAAGCAGAACAGAGTGT
ACAAGTGTGCAGTCTAAGGTATTTTTTCCAACTTCCGATTTAAGAAAGGTTCACCATTTTAGAGGAGCATAAGTATGTACTTGAGGTAGGGTACTGGGTA
CATACTATCCGTTGCAGATGTAATTCCACTGCTTTCAAGTGTATTCTGATGTGATGTGGCAGTCTTCAAGTGATTGGGAGCTCTGAAATGGATTCCCAAT
AGCATGCTATAGTCAATAATCGA
page-top