Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok5l11
Contig Information
Length 750 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok5l11   
Homology (BLAST) Top Hit hypothetical protein OsJ_002928 [Oryza sativa (japonica cultivar-group)]
Score 287
Evalue 4.61444e-24
Total Hit Count 130
Registered year 2003
Contig Sequence     [ Download ]
>rwhok5l11
ATCTGATGATGGCGTCAGAGATTACAAGAAAAATAAGCCTCACAATATGTTAATGTACAAACTTAGCACTTGAGGCCGAGGCACCTCCAGCGATAATAAA
ATGAAAAATCAAGCAGCAGCAAGGAACGACATACTACATACAGAGATCTCGTTAATTTCCAATGCCAAGCGAAAGATTTCTTATCACATTACAACAAGTA
CAGTATTCCAGATGAACTTGACATTCGTAATTGTTTTCTTGGGATAGTAATCGTTATTTGCTACTATATCTCACTTCCCTCCAGAGTTGGGTTTCGCAAG
CAGCTTCTTTGGTAGTTTATCCAGTGGGGTTGTTTTCAGAAGGAACAGTCTGGCCGCGCGCTCTTTTAAAGTGCCACCACATTTTAGTCCATGAGTCTGG
AGCTCCAGCTTTAGCTTCTCCATGCCAAGTGCCTCCAATTCTGCTGCTGAACTGAATGTTGCCAGGTCCACAGGCTCCTCTGAAAGAAGTGGCTTGTTAT
TTACATCAGCAGATTCTTCTACTGGAGGCACCACAGGGTCATTAAGGAGTGATGATGTAGCTGAACCGGTGTTATCCACATCTGTTTTATCATCTGATTT
CANAACTTCTTCTGAAAGAGCACTCTTACCATTCTCAGAAGTTCCATTTTCAGAAGTGTTCTCAGGGAGCATCTGATTTCAGAACTTGTTCTGAAAAGAG
CACTCTTACCATTCTCAGAAGTTCCATTTGCAGAAGTGTTCTCANGAGCA
page-top