Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok5l08
Contig Information
Length 779 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok5l08   
Homology (BLAST) Top Hit Os02g0550300 [Oryza sativa (japonica cultivar-group)] >gi|113536624|dbj|BAF09007.1| Os02g0550300 [Oryza sativa (japonica cultivar-group)] >gi|125582468|gb|EAZ23399.1| hypothetical protein OsJ_006882 [Oryza sativa (japonica cultivar-group)]
Score 518
Evalue 8.12943e-51
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>rwhok5l08
CAGTCAATAACTTCACATGGACATAAACTAAATAACTTCACATGACATGAAATCGCTAAACAGAGGAGCTAGTAACTGCCAGGTCAGACAAGGGGAGGTC
AAAACTAAGGCATGTGAAATCCAAAATCAGAATATCCTCATTCCAGGTTCCCCTTTCTACAACATCCATTCTATTCTTCTGCTACAGGAAATCCTTAAGT
TTAGTCTGGAGCCGGAAACTACTACACATTCATTCTTGATGGGCTCGTGTTGGCTGGCGGTCTTCCTCGCCTTGCCCAGAGAAAAACATTAGAACAACAA
GCACAGCCACCAATAAGAGGAGGATGTACAACGCATTCACACCAAGCAGCGTTGGGAAACGTCTGCCAAATGTCTTCTTTATTGTTCTTCCAGCTCTATA
TGCCTCGAGGAAACGACTAATTTGGGATCCATGATCACCTTCTTCCAACTTCTCTAAACCCTCAACCACTTCATACTTCTCATCTTTGTCCCAGACTACC
AACTTTGGCAGCTGTGAGCTCTTAGAATCATGGAAAGGCTCGGTGAATTCCTCCCATTGGTTGACTCCCACATATCCAAACACTAGGTCATGGTTTGCAT
TGGCTGCAGACCTTAAAATTTTTATCAACCGCATGGAAGTTTCATCAGAATCATCCTGCAGAACTGCAAGGACAACTTTCCTATCGTCATCTTTTAACAT
CTTAACAGTCTCTGCATTGATGGGCACAGTCATCGGAAGCAGGGATTGCCGTATAAAATCCTCCAAGAAGGTTCCTTCA
page-top