Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20j09
Contig Information
Length 578 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20j09   
Homology (BLAST) Top Hit hypothetical protein OsI_14354 [Oryza sativa Indica Group]
Score 405
Evalue 5.39984e-38
Total Hit Count 54
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20j09
AATGGTTTCAATCCTAACANCCGAACTGGGTCATGCTGTATTTTACCAAATGCAACTGAAATTATTACTTCAGGAAACGAGTGACACTCTCTTATCGCAC
AGAGATTACAACAGCTCATGTGCCAACAAACACAAAGGTAAACAAGATACGCCTCATATTTACAGCTCATCGTGAATGGTACATGCAGGGTGATATCTTG
CAGCGGTACATACAAGCTCTGGCAAGCTTGGCATCTGACCTTTTGAACGTCGATAGGGTGAGACAAGAGATATCGTCCTTCACAGCACCTCGTCTTCGTG
GTACAGGTACAGCCCAAAACCGAACCTTGCGCAAGCCTTGCAGAACGCCGCCTCTTCTGCAGCCGCCACGGGGTCGTCGAGCCGTGCATCGCTCAGTGAA
GCTGTTCCAGCAGCCTCCCGATGAACCTCTCCATCTATCCCTCGTATTGTGACGCGGTACACCACGGTCACCTTCCCATTGTCATTGTAAATAACATCAC
GGACCTCTCCACACCAGCCGGGGGCGTAGAAGCTGAGCATCCGGTTGGCATGGTACCATGGGATGGCGGGGGCGGAGG
page-top