Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19f07
Contig Information
Length 748 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19f07   
Homology (BLAST) Top Hit L-ascorbate oxidase precursor [Zea mays] >gi|219888169|gb|ACL54459.1| unknown [Zea mays]
Score 1012
Evalue 3.90723e-108
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok19f07
CCGACCCCCGCCACCCACCTCGCTCCACTGCACGCTCGTCACTCCCTACTGAGATAGCACAGTGGACAGCGGCGTCGGTGGTAGGAGTGTGCAAGCGCGT
GCGACGAGGGGTCTGGAGATGTCGCCGCCAATCTCGCTCTGCGTCTTCGTCCTCCTCTCCTCCCTCCTCGCGGCGGCCAGGGCCGAGGACCCCTACCGCT
TCTACACCTGGAACGTCACCTTCGGCGACATCTACCCGCTCGGCGTCAAGCAGCAGGGGATCCTGATCAACGGGCAGTTCCCGGGGCCGCAGATCGACGC
CGTCACCAACGACAACATCGTCATCAACGTCTTCAACAACCTGCCCGCACCATTCCTCCTCTCCTGGCAGGGGATTCAGCAGAGGAGGAGCTCATGGCAA
GACGGCGTGTACGGCACAAACTGCCCGATCCCTCCAGGGGGCAATTTCACCTACAACATGCAGTTCAAGGACCAGATCGGGAGCTACTACTACTTCCCTT
CTCTCGCGTTCCATAAGGCGGCGGGCGGGTACGGTGGCATCAGGGTCCTTAGCCGCCCGAGGATCCCTGTTCCGTTTGACCCCCCTGCCGGTGATTTCAC
CATCTTGGCTGGTGACTGGTTCAAGCTCAACCACACTGATTTGAAAGGCATTCTGGACAGTGGTAACGACCTTCCCTTCCCTGATGGTCTCCTTATCAAT
GGCCATGGCTCGAATGGCAACAAGTTCACAGTAGACCAAGGCAAAACA
page-top