Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok18o02
Contig Information
Length 129 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok18o02   
Homology (BLAST) Top Hit hypothetical protein OsJ_006732 [Oryza sativa (japonica cultivar-group)]
Score 180
Evalue 4.00503e-12
Total Hit Count 78
Registered year 2003
Contig Sequence     [ Download ]
>whok18o02
AAATTTGGTGAGTTAACTGTTCANGCCNAANAAAGTGCTGGTTCAAAAGCATTAATGGAAATGGTATTCCACTGTTCAGATCTTGAAATCAAGGATCTTC
TTTCAAAAAGTGATCCTTTCTTGCTAATA
page-top