Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20j17
Contig Information
Length 176 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20j17   
Homology (BLAST) Top Hit Histone cluster 1, H3i [Homo sapiens]
Score 273
Evalue 6.54699e-23
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20j17
GCACTGGAAAGGCAGCTTGCGGATCANCAGCTCCGTGCTCTTCTGGTACTTGCGGATCTCCCGGANCGCCACGGTCCCCGGCCTGTAACGGNGGGGTTTC
TTCACTCCGCCGGTGGTCGGCGCCGACTTCCTCGCCGCCTTGGTGGCNAGCTGCTTGCGGGGCGCCTTGCCGCCGG
page-top