Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20k05
Contig Information
Length 633 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20k05   
Homology (BLAST) Top Hit plasma membrane intrinsic protein [Hordeum vulgare]
Score 627
Evalue 1.2066e-63
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20k05
GGTCGCTAAATTTAAATACAAGTAGGAAAAGCAATGCGGGCTAATTAAGACAAGCGATCCCATGGACCGAATTACAAGACACGGCACGCATGACCGGACC
ACGTACTACGCATATGCAGCTGCCGACACATAATAACACGACCATTGCGGCGGCCGAACTGAACTGTCGAGAAGTTGCAAAAGCGCATTTCTCTCTGGAT
GGATGGACACAACACGGGTCGCCATTGCTTCAGTCTTGCATACAGATGACATGGATGATAACTTGTTACGCGTTGCTCCTGAAGGAGCCGAGGGCCTTGA
TGGCGCCGGCCCTGAGGATGTACTGGTGGTAGAAGGCCGCGATCGCCGCGCCGATCATGGGGCCGACCCAGAAGATCCACTGATCATCCCAGGCCTTGTC
CTTGTTGTAGATGACGGCGGCCCCCAGGCTCCGGGCCGGGTTGATGCCGGTGCCGGTGATGGGGATGGTGGCCAGGTGGACCATGAACACGGCGAAGCCG
ATCGGGAGGGGCGCCAGCACCGGGACGTGAGAGTCGCGTGCGCTGCGCTTGGGGTCGGTGGCGGAGAAGACGGTGTAGACGAGCACGAAGGTGCCGATGA
TCTCCGCAGCGAGGCCGGTGCCCTTGGAGTAGC
page-top