Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok18o23
Contig Information
Length 820 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok18o23   
Homology (BLAST) Top Hit glutamine synthetase, catalytic region [Thermoanaerobacter sp. X514] >gi|166853453|gb|ABY91862.1| glutamine synthetase, catalytic region [Thermoanaerobacter sp. X514]
Score 79
Evalue 7.11507
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whok18o23
AAATTCTTATATCTTTCGAGGGCACGTATATCTACCTGTAACTTAAAGTAGATAGATTGCAGTAATCCTTTCGAAAAATATATATTGCAGTAGTAGGTGT
TCCTTGTATGAAGCAGATTCGTGGTGTCATTGACTGCATTCTTAAGTTGGCATACATGAGACATAGTATCATCAAGCAGTGTAGAAAATCATATGTATTT
GTCGTATTTGTCTTTGTTTAGATGTGTGATGTAACCATGCAAATTATTTCCCTGTATTTATCTTTTTTTTCTCAGTGCAAATTGGGAGTGAATATGTTAA
AAGTAGTCAGAATCGCGATTCTGTTGTACGATTCTACGACTTGACAATCCAAACTAACTCATGATTCTATGATTCTGTTTGGTAAAATCTATGTTTCTGT
GATTTTCGTAGTGAAGATTCTGCGATATGCGACCCTACCATTAGGGCCCCGATCCGATTCAGAATCACGATTCTGACTATCAACCTTCGAATTTGGCATG
CTGCGTTACTATCCAAAACTGTACACTCTCATATAAAAGTTATCTTCATAGCTTTATAGCCCTTCCCCCTTTCCCTTTGCAATCATCTTGAGCTCACATA
ATTGGAATAAATACACCGATACGCTATATTCTTGAGTGATAACTTTGTTTAACTAAGATGTCAGTTCATGCAATGCAAGACTTTCACGTGCCCTAAATTT
GTTGGTTACATGACTTCTTTACTAACTCCAACCACTTCATCAACTTACCTAATCTTGATTTGTTGTCTGCTTTGNGATATGTTGACCTACTGNATAAATT
TGTGCTGGGTTCTGTTCTAA
page-top