Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19c12
Contig Information
Length 747 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19c12   
Homology (BLAST) Top Hit hypothetical protein An14g00470 [Aspergillus niger] >gi|134081343|emb|CAK41846.1| unnamed protein product [Aspergillus niger]
Score 82
Evalue 2.67796
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>whok19c12
CCCTCGATCCCCTCCATCGCCTCCGCCGCCGCCGAGGTACGAGGTCGCCTCCATCTTGTTCCTTCCCTGGCCACGCCCCTCCCAATTTCTTCCCCTCATC
CAGCTAGGGTTCTCACCCGCCGCCGCTTCCCTGCTGCTACCCGCCACCGGATGCCCTCCACGGACACCACCACCATGATGGCGGAATGAAGAGCAAGAGG
GGTCATCGAGGATGGGTGCCGTCGTGAGGTTGCTGGTGCCCGTGTGCGGTGATGGCATTGTGGCGGAAGAAGGTCTTCTTCCTGGGGAGCCGCTACCAGC
CTCCGTCTCCACCCGCGGCCACACTAAAAAGACAGAGTATTTGTGATGTATCCTTCACTTACCGTGCCACGGGGTTATCACGGATATTGGTGGAGGACTT
GGTGGACTAGCGCAAAATGGAAATCTAGAAAGAAGTGAAACTAATCAGCTATGGTTCTCCTGGAGTATTTGTGCAACCAGCAGGCCGCCCATGAGAAATA
TGATGTTCTTTATGCATTTAAAAAACTACTAAAGGGAAAGTTGTGAATGTAGCGTATGCGTCAGAGGCCAGTCGGCAGAGGTGCATGCAGGTTTGTGCTT
GAGGGTGCACGCGAGCCGGCGGCTACAGGCAGAGGGTGCGGCCTGTGTGTGCGTGTTGTGGTCGCCTGATTTGATTGTAAATCGTGTANAGCAAAGGCGG
CTTCTGTGGCGCCGGANCAACAATTTCANTGAGCACATGGACTTGAT
page-top