Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19b12
Contig Information
Length 798 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19b12   
Homology (BLAST) Top Hit putative kinetochore protein [Hordeum vulgare subsp. vulgare]
Score 1048
Evalue 2.97232e-112
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok19b12
CTAATCCCTACCCCCACCCCACCCGCCGCCATGTCGATCCACGACCGCCGGCCGTCGCGTCCCCTGCCTCTGAGCACACCAAATCCAAGAAAAAGAAGAG
CAAATCCAAGGACGCCTCCGCCGACCCCGACCCCGCCGCCGCCGCCGCCGATACCACGTCGCTGGCGGACGCCGAGGCCAAGACTGATGGCTATATGATC
AAGCCCCAGGCCCTGGTTCCGTCCCTCGACACCTCCACCTGGCCGCTCCTCCTCAAGAACTACGACCGCCTCAACGTCCGCACCGGCCACTACACCCCGC
TCCCCTCCGGCCACTCGCCGCTCAAGCGGCCCCTCGCCGAGTATCTGCGGTACGGCGTCATCAACCTCGACAAGCCGTCCAACCCCTCCTCCCACGAGGT
GGTTGCCTGGATCAAGCGCCTCCTCCGCGTCGAGAAGACCGGCCACAGCGGCACGCTCGACCCCAAGGTCACCGGCAACCTCATCGTCTGCGTCGACCGC
GCCACACGCCTCGTCAAGTCGCAGCAGGGCGCAGGTAAGGAGTATGTGTGCATCGCCCGCTTCCACGCCGCCGTCCCAGACACGGCCCGGGTCGCTCGCG
CGCTCGAGTCTCTTACCGGCGCTGTGTTCCAGCGCCCGCCGCTCATCTCAGCGGTCAAGCGCCAGCTCAGGGTGCGGACCATTTATGAGAGCAAGCTGCT
GGAGCATGACGCCGAGCGCCACCTTGCTGTGTTCTGGATCTCCTGCGAGGCTGGAACCTATGTTCCGGACGCTCTGTGTGCACCTTGGGGCTGCTCCT
page-top