Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20l01
Contig Information
Length 816 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20l01   
Homology (BLAST) Top Hit hypothetical protein OsJ_021458 [Oryza sativa (japonica cultivar-group)]
Score 849
Evalue 3.65124e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20l01
CAAAGTTTGCGAGAACTCATGTTGATGGGAAACCATGAATGTACATATTTCAAGCACCTAATTTCCATCACATAGACTTGAAGGGCACTGAAGATAGCTA
CAAACAAACTTGTGAAATGCTTTGTTGCAGGCATTTTCACTAATGAGAAGGCAATGCAAATTTGACATTGCAATCAGATGATCAAAATGGCAATTCGGCA
AAACCACTCTAAGGTGTTGCCATCTTGGCAAATCCAGAAAGTGAAGCGATTGCTTCCCCGGTGGTCAAATACAGGCAGTCCGGCCTGAAATGATTGTGCG
CGTCATTCGCTCGTTGTATTTTCTCCATGACCTCTCCAGTTGGATTCACAAGTACAAGCTCTAGGCCATGTTTCTCTATTGACTTCTTTAGGTCAATGAG
GAATGCTATGCCACTTGTGTCAATTGCAGGGACAGCTGATAGATCCAAGATTATGACACGGAGTTCAGTTTGTTTATTCCCTGAAGAACTTTCATCCTCT
ATCCATCTTTTAGTCCTTTCATTCAGATAGTTGGTGTTTGCAAAGTTTATGGGGGCCTCAATTGTCAATATCAAGAACCCAGGAACTCTTTGAGCTTCCT
TGTACTGATGGAGGTTTCGGTAAATATCTGTTCCCTTAATGTTGCCCTGAATCATCATCCTTGGCCTTGTGATTTGCATCAACACCCTAAATATCGATAT
ACCAACCGCAATCGCAAGGCCTTCTTGGACCGAGATGAAGATGACACCAGCAAATGCGCACAGACACACGAGGAAAATCCATCTTGTCCATCTTCCAGAT
GTTGTATGCAGCAGGG
page-top