Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19c19
Contig Information
Length 228 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19c19   
Homology (BLAST) Top Hit RecName: Full=Thioredoxin H-type; Short=Trx-H; AltName: Full=TrxTa >gi|2995378|emb|CAA49540.1| unnamed protein product [Triticum aestivum]
Score 300
Evalue 4.95377e-26
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok19c19
CCGCCAANAANCTGGTGGNGATTGACTTCNCTGCATCATGGTGCGGACCATGCCGCATCATGGCTCCNATTTTTGCTGATCTCGCCAAGAANNTCCCANC
TGCTGTTTTCCTCANGGTCNACGTNGATGAACTGAAGCCNATTGCTGAGCAATTCAGCGTCGAGGCCATGCCANCCTTCCTGTTCATGAAAGANNGAGAC
GTCAAGGACAGGGTTGTCAGATCTATCA
page-top