Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20l02
Contig Information
Length 126 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20l02   
Homology (BLAST) Top Hit unknown [Zea mays] (no hit)
Score 359
Evalue 7.05987e-33
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20l02
CTATATGAATATTTCACCTTTACAGTCGAACTCATTCTCTNATGGATGAANTCAGCTGACATGGTTTACACATGCCTGCTAAATAAATTTTCTTCCTGTG
CGCCCAATGAACTGCCACTTTGTANG
page-top