Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20l21
Contig Information
Length 849 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20l21   
Homology (BLAST) Top Hit hypothetical protein OsJ_033752 [Oryza sativa (japonica cultivar-group)]
Score 1106
Evalue 6.23584e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20l21
CTCTGGACTCATCATCTGTAGAGATGAGCGTCTGCACTACATTCTTCATACCGGGCCTTTTGTTTCTATCTTCCTCTAAACATGAGACAGCCAACTGGGC
AAATATTTTAGCTTGCGCATGGTTAAATTCGCCATCAAGCCGTTCATCCACCAGGTCCGCAACCCATCCTCCATCGCCGCGCTTCGATCTGTCGACGATC
ATCTTCACCACGGTTCTGACATCAGTTTCAAGCCCCTCTTTCCCATCCACCACCCAATCCGAAACCCTCTGCCCTTTCATCAGTTCCAGGAGCACCACGC
CGTAGCTGTACACGTCGACCTTCTCGGTGATGGGAAGGCTGGAGACCCACTCGGGTGCCATGTACCCCCTTGTTCCTCGGATCCGCGACAAGCCCGAGTC
GGACCCGTCTCTGTTGAGCAGCTTCGCCAGCCCGAAGTCGGTGATCTTGGGCTCCATTTCATCATCCAGCAGTATGTTCTCCGGCTTCATGTCGCAGTGG
ATGATCCACTCCAGGCACTCATTGTGAAGGTATGCCAGTCCTTTGGCCACGCCGACGGCGATGTTGAACCTCTGCTTCCATCCCAGCAACCTGCCGGAAT
TTCCGGTGCTTTGGAACAGCACATTTGCCAATGATCCGTTGTGGACGTACTCGTAGACCAGAATCCGGTGCGCGCCTTCTGAGCAGAACCCCCACATCCT
CACCAAGTTCATGTGGTAGATCCTGCCGATCGCGCTCAGCTCGGCTTGGAACACCTCCTCGCTCTGGCTCACGTCCTGCAGCACCTTGACGGCCACCGTC
CCTGTCGTCGTCCAGGACCCCCTTGTACACGGTGCCCGAACCCGCCATG
page-top