Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20m04
Contig Information
Length 858 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20m04   
Homology (BLAST) Top Hit ribonucleoprotein [Aedes aegypti] >gi|108872624|gb|EAT36849.1| ribonucleoprotein [Aedes aegypti]
Score 104
Evalue 0.00981957
Total Hit Count 295
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20m04
CTCTCTTCCACTTGAAATGCTTTTTTCTAGAGAAGAGGCGATGGCCGAGCCTTGGGCTCGAACCTAGCCCGGCTTTGAATTAACAAAGCCATCAACCGGC
CACGATTACACCACTTACAAGAAAGGAAAACAGGGAACGACAAAGATACGGAGTGCTACAACAGCTCATAGCCAACCAACAATACAGGNGAGCGAAAGAT
ACAAGAAGGAGCTCAGCCTGAATTACCACAGCCTAACATCTAGAACAGCAGCTAGCTCGGCCACAGGAGAGAATCAACCAGCAGCACCAGCAACGGTGGC
CATCGCCACATCGCCTACTCCGGCAGAACCTGCTAGCAAGCCATCTGATTCCCCCTCCAAAGAGGACCACAATCTTCTCGCCCTGGCTCGAAGGGCGTCG
TACCGTCGGGAGGTAGGAAGCTCACCGAGAGCCGCATGAACAAAACCAACAGAGCACCTTAGGCAAGAGGAACCAGAGCTCAAACCACAGCCGCAGCGCT
CCCACGACCTCGCCACAAGCACAGCCAACCGCACATCCAAACACGAGCTGAAGAAAAATACTGCACAACGAAGACCGGCGGAAGAAGATGCACAGAAAGC
CGCCACCAACCGCAACCAAACCTGCAGCAAACGCCAACCTTGCTTCCATGCACCCCGGATGGTGCCTCCAGGAAGGGATGCGACGACAGAACGCCGCCAC
CGTCCTCAAGGGGAGCTGGAGCTTTCGCCACAAGAATGCAAGACGACGGGAGGGAGGGGACCTCGACAAGGCCTCCAAGAAGGTAGCCGACGCCAATCCA
TGGCGTCGCCATTGTCCTGGCCGCCGCCGATGACCAAGGGTTTCCCCCCGGTCCCGCT
page-top