Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20m05
Contig Information
Length 165 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20m05   
Homology (BLAST) Top Hit hypothetical protein OsI_30256 [Oryza sativa Indica Group] (no hit)
Score 1197
Evalue 1.56877e-129
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20m05
TACTGNAACATCTCAGTCAATTAAATCANATACGGNCTGTGGGACTATGATTAACCAAAACAGTGCAAATCAATCTATTANAAGACAAAATAATGCTCAT
TTAAGAAAATATCAACANCAAGCACTCATTCAACTGCACCAAAATTAACAGTACCATAAATCTGG
page-top