Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20n23
Contig Information
Length 265 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20n23   
Homology (BLAST) Top Hit Os05g0150500 [Oryza sativa (japonica cultivar-group)] >gi|113578217|dbj|BAF16580.1| Os05g0150500 [Oryza sativa (japonica cultivar-group)]
Score 314
Evalue 1.01723e-31
Total Hit Count 98
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20n23
AAGGGATCGCATTGTCTCCANCTTGGCAGCATTTGCCAGCAACGGCTTATTTCCAAATGGGCAGTCCCTGATTTCCAGCTTCTTCAGGCTCTTGCAGCCA
GAGAGGATATAATGCANGCCAAGATCACTGTTCCCAGCAAAGGCGATTGACAGCATCTCAAGACAATTACCATTTGCACCGATTGATTTGAACACGAGAT
CTGTGAGAAGGNCCANACACAGAGAGGCGCCTAAGGCCCTTGCATGATTCCACAATGGCACTGAA
page-top