Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10g03
Contig Information
Length 302 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10g03   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 149
Evalue 1.57941e-08
Total Hit Count 169
Registered year 2003
Contig Sequence     [ Download ]
>whok10g03
GAGCCCCCACTCCACCCCAGAGCAGAGCCGCGAGCACACCAGCAAGCAGCAAGCCAGTTACGCTCGACACCGCGGCACTGCTCGGCTCGGCCCCCTTCTC
GCTCGCGGGAGCACGCGGAGAGGCCATCGAAGATCGGCCGACCGCCGGCCGGCGAGCGATGTCGAGCCACGAGGCGTGCTGCGGGACCATGTTCTGGGTG
TACCTGCTGTCCTGCGCGGGGCTGGTGATGTTCGCGGGGCTCATGTCGGGGCTCACCCTCGGCCTCATGTCGCTCAGCCTGGTGGACCTGGAGGTGCTGN
NC
page-top