Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10f22
Contig Information
Length 793 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10f22   
Homology (BLAST) Top Hit hypothetical protein OsI_00169 [Oryza sativa Indica Group]
Score 1065
Evalue 3.15178e-114
Total Hit Count 169
Registered year 2003
Contig Sequence     [ Download ]
>whok10f22
GAGGACTCCAAAACCATCTGTCCTGGTCGTATATTATGCCAAACTAACTGAAATATTCTGGATATCCGAGAGTCACTTGTATCATGCATATGCATGGCTG
AAGCTTTTCAACTTGCAGAAGAGCTTCAATAAGAAGTTAACTCAGAAGGATCTGCAAATACTAGCATCTTCTGTTTTGCTCGCTGCACTTTCTGTTACAC
CATATGACCATAAATATGGTGCATCTCATCATGAGCTTGAAAATGAAAAAGACCGTAGCTTGCGTATGGCCAACCTTTTCAATTTCTCCTTCGACTCCAA
GCGTGAAAATAGAGAAATGGTTTCTAGAGCTTCTCTTCTTTCTGAGTTGGCTGCCAAAGGTGTGATTTCATGTGCTTCCCAAGAAGTGAAAGATCTATAC
AATCTTATGGAGCATGAGTTCCTTCCTCTGGATCTAGCATCGAAAGTACAGCCTCTGCTTTCTAAGATTTCTACGATCGGAGGAAAGCTTTCAGCTGCAT
CTTCAGTTCCTGAAATTCAGTTATCACAGTACCAATCTGCCTTGGAGAAGCTTACAACACTGAGGGTGCTGCAGCAGGCATCTCGTATTTTCCAGTCCAT
GAAGATTGACATGCTCTCCAGAATGATCCCATTCTTTGACTCCAATGTCGTGGAGAAGATGGCTGTTGATGCGGTCAAACATAATTTTGTTGCTATGAAA
GTTAACCATTTGTCTGGAGCTGTTCATTTCGGCAAAATGGACATAGAGTCTGATGCACTTGGTAGTCACCTCTGTGTCTTCACTGATTCCCTA
page-top