Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20p05
Contig Information
Length 787 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20p05   
Homology (BLAST) Top Hit Os08g0119000 [Oryza sativa (japonica cultivar-group)] >gi|42407907|dbj|BAD09047.1| putative COP9 complex subunit 3, FUS11 [Oryza sativa Japonica Group] >gi|113622839|dbj|BAF22784.1| Os08g0119000 [Oryza sativa (japonica cultivar-group)] >gi|215708775|dbj|BAG94044.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765037|dbj|BAG86734.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218200399|gb|EEC82826.1| hypothetical protein OsI_27624 [Oryza sativa Indica Group]
Score 998
Evalue 1.80994e-106
Total Hit Count 272
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20p05
ATGGCTGTAATATACGGGTCGAACCAATAATAACCTCAGGACNAGGCTANCTTGATGGTAGTACTTCCGAGACACCTAAGGCGCTGATCATCTCAAAAAT
ATTTGTGCGGAACCGAGTCGAAGTCATCGTAGTCGAATCTTGCACGTTCCCTTCCACTCTGCACCTTCATCAAAAATGCATGATCGCACGAGATGTTCTG
ATCAATTGAGGTCAGCTTCTTGGACAAAGCCATCAACCTTTGAATAGAAGAGTCGATGTGCTCCACCATCTCACTANTTTTATATTGCTCGGGATCTTCN
TTAAAGCTGACCATGCCATCCTTCTGGTTTATCGTTGCATGGATCTCACCATCTTCAATCATCCTAAGTACATGCATCTCAGCTTCTTTCGGGGTGTTAA
GTTGAACAGAGCTGGCAATGTCTTCANGTGAAAGAGTTAAGTAGGTCTGGGTCAGCCTCTGGATGTTTCGCTTGTACATTGAAGAAAGAACTTGCTTCAC
TAGTCCAAAGTTGTTATCAGTTTGGAAGGCCTCTGCATTTGACTGGATGAATGTCTCCAAATCAGAGTAGCTACCAGTACCATAGCATGTAGACAGATCG
ACGTAAATCTGAGTGTGATTTTTCAGATTCCTTTGAGCAGTCGAAGATGTGTACTTGGGGAATGACGGAACCTGTCCACTCTGAATGAGTGAAACTAGGA
CATACTTCTTGTAAGCCTCGACAGTAATTGCATTCAATGACGACATTGGGGCAGTAACAGCATTGTGAAGAAGCTCCAATGCTTTAC
page-top