Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok5k22
Contig Information
Length 718 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok5k22   
Homology (BLAST) Top Hit subtilisin-like protease precursor [Zea mays]
Score 758
Evalue 1.02833e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhok5k22
TTTGGATAAGCGTGAATACATTTGTGGAATAAAAGCTTGTTTTGAATTGGAGCTTCACAACATCTTTCTTCCGGCAAGTGCTGCTCCTGTGCTGCTGGCT
GCTGCTACGCAACTGATTCATCAACCTCGCTTACCAAGGGGCCAGGGCACAGCTGCTTCTGCTCCCAGACCCTCTGACTAATGCGGAACAACGATACAGT
ACTAGGGGAAAAGCTCACATTGGCGGCAGCCATGTGAGGACCAGGGGGCTCCGGACTACGTGAACGCCGTCGCTCCATGACAGGGCACCGTACTCGGGTG
TCTTCTGAGCGGCCTTGGTCCTCACTGTAACCTTGTATGCGAGCTTCTGGTTTGCGCTGCTGAAGTGCAGGGTGCTCGGCTCGACGATGACGTCCGCGCC
TTTGAACTTTGTGACCTTGACATGGTACGTCGATGACGGAGGACCGACGTTTGTCACGGTGCGGTGCACTGCCAGCGGGGTGGACGGCTGATCGGTGAAG
ACGGCGGAGATGGCCGGGTAGTTGAGGTCGCCGGGCGAACTGAAGCTGCCCTTGCATGTCATGTTGGAGTTCTTGGTGAAGCCCTTGAGCTGCGTCGGCG
TCAGGTTCTGCGTGCANAGGAACTCCAGGTACTCGTTCTGGCCAATGTCGTAGACCAGGCCTGGGTTGAGCGCTCGCACCGGGTGTATGTGGCCGGCCCC
GTGCTCGAACGGCGTGGA
page-top