Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10f04
Contig Information
Length 779 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10f04   
Homology (BLAST) Top Hit hypothetical protein OsJ_035582 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 361
Evalue 1.51237e-32
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whok10f04
GCACCGGTTGGTTTAAGGCGATTTATCCGCCTTCTTTGTGGAACTATAGCTAGTTATTGTGATAGAATATATGCATCCACCTTCCCATTTTGTCCTTGCT
CACTCTCACAATGGCCTGCAAAGACTTGGGTGTTATATTAGGGTTTCTGTTTACTGTATTGTATTTATATATTGGAAATTTATGTTTGCATCACCAAAGT
AGCAGGATCGCATACCATGGTTGTCAGGTTGTTTGTGACTGCTTAGGTCTCGTATGTAATTTCGCACCAGTAGATCATAAAGTTGTAGGAGACATTTTAG
GCACTTTGCAATGTTGTGGCAGTTGATCATAAACTTATGGGTGATTTGTTCCCTTAAATGGTACTAGAATTTTGAAGTTATGAGTGTTATCTGTGCTTTT
AGCCTGCTGTATGCCTGTATCTGAATTTAGGTTCTAGAAGTCTGTAATCGGAGGAGAACTAGGGTTTATTTTTTTTGAACTCGAACGGCAGGTGCTCTGC
CTTTTCATTAAAGGTTAGGAATATACAAGGAGTTTAGCAGTCGTCAGAAGGCGCTGCCTGTACATCTGATGATTGGAGTAAGTGGGTACGTACTGATACA
AAGATAGGACCTGGAAGCGTTGCGTGCACCTATTGGTTTGAACACNATTTATCCACCTTCTTTGTGGAACGATAACTANTTTTGTTGATCGAATATATGC
ATCCACCTTCCTATTTTTCTCCTGACTCACTCTCAGAATANCCTGCNAANACTTCNNGACTCATGTTACTGNTTCTACC
page-top