Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhok20p06
Contig Information
Length 846 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok20p06   
Homology (BLAST) Top Hit hypothetical protein OsJ_035582 [Oryza sativa (japonica cultivar-group)]
Score 361
Evalue 1.51237e-32
Total Hit Count 114
Registered year 2003
Contig Sequence     [ Download ]
>rwhok20p06
ATCATCATCATGGTTATTATTCACAACCACTTGGCTAGCATAAAACACCACACAAGATCTTGGGGAGTAGGATTACAAACAAAAAAGATTGCAAGGCCAC
ACCATACCTATACAACAAAGTGTTTCAATTCCACGATGGGAATTGAATAAAAACACCACCAAATCTCATCAACGACACTAACTTCACCCGACTCGAGTCG
CTGATTGATTGATTTCCGCGACCACGAGATGTAGTAGGCACGATTGATTAGGGTCAGGCTCAGACTCGACACTTCTGGGCACCAAGATGCAATGTCTTCT
TGTTTTCTCTACACAGAAGTCAGCAGAGGGTCCCTGGATGCCATGATTCAACTAACTACACAAGAGATGCTCCAAGGTCTTTTTAATACTTCATATCAGC
ATCACATGTTGCGTGCTGAACCGCTCCGAGGCAGAGTCCTTCCAGGTGGCATCTGTGAGGCAGAGGTGCTTGAACTGCCGAACCTTCTTGCTTTCGTATC
CTGCTCTTTCTCTAATCGCATAGCCACCACCTCCTTTTCCATGGCAGCTACATCCCGTCCCATCTTCTTAGCCTCTGATTCCATCGCCTTTGTTAAAGTA
TCGATTTTCTTAGCCAACATCTCAACTGCATCATCCTTGTCTTTCAAGCTTTGGTCCTTTTCATGACAAAGCCTTCCTGAGAGCAACGACCTCCTTTTGG
AGCATATCATACAGCATACCTGACACCGTGTCCTCCGACTAAACAGATGTAAATTCACTAGGCTTCTCATCTGAGTTGTTTGACTCCTTATCCTCGCTGG
AGTCGGTAGATACGTTCATGCCAAACCCCATTTACATGGCCCTTAT
page-top