Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok19c01
Contig Information
Length 274 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok19c01   
Homology (BLAST) Top Hit plasma membrane H+-ATPase [Triticum aestivum] (no hit)
Score 1246
Evalue 3.21443e-135
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whok19c01
TGATCTGCCTACGGTGCTGTGGCCCGTTTGGGCGTCCCGCTTANCAGTATCATTGTCATTGNTTGGTTTCCTGANTCCTGATATATCCTCGGATATCGAA
CATCGTTTTTAATAATATGGAACTTGTGCTTTCATAATACCGTACTAGTTTCTTTTTGGAGTTGAAGTACCCTGAAAATCGGGTGCTGCGTATCGTAAAT
TGGAGCANGTTTTTGTTCCATGGTCCTGTAATTTACCTGCTCATACAATGNTAAAACCTGTCATATTCTGAGTA
page-top