Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok6n08
Contig Information
Length 743 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok6n08   
Homology (BLAST) Top Hit hypothetical protein OsI_21793 [Oryza sativa Indica Group]
Score 816
Evalue 2.07817e-85
Total Hit Count 247
Registered year 2003
Contig Sequence     [ Download ]
>whok6n08
CCAGCGGCTTCCACACCGTACGCCACCGCCCACCGGAGCCCCAATGGCCGCCGCCGGAGACCTCAGGTCGGAGTACCTCCAGGTCCTGCTCAGCCGCCGC
CGCGAACCCCAAGTGCCTCTGTCCGTGGAGCAAGGGACTCCGGTGACGAAGCCGCTGTTCCAGGGCGACTGGCCTCTGGGGCCCAGAGAGGCCATGGAGT
CGTGCCCGAGGAAGGAGGTGGAGGACTTCCACGAGAAGCTGGTCGAGGAGAATTTCTTCCTGATTACCGAGTCAGGTGAGCAGGGGCGTGTACCTGTACT
TCTGCTGAAACTCAACGACAGTACTGCTCCCGAAAGGAAGCCGGTTGTTGTGATACTGCACAGCTCTTACAAATGCAAGGAATGGGTGCGTCCACTGCTA
GAGGCATATGCCTCCAGGGGTTATATTGCTGTTTCCATCGATTCTCGCTATCATGGTGAAAGCGCCAGCCACAAGAATACTTACACCGATGCACTGAAAG
CAGCTTGGAGGAATGGGGACACGATGCCTTTTATTTTTGACACGGCATGGGACTTGATAAAGCTTGCAGATCATCTTAGTGCAAGGAAGGATGTCGATCC
CTCAAGGATTGGGATTACTGGTGAATCACTCNGAGGAATGCATTCATGGTTTGGTGCTTTCNTGGATACACNGNACANTGTTGTTGTTNCNATANTTGGT
TTTNANGNATTTNNNNGNNNANTANANNNATANNATGTNNNAA
page-top