Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10d16
Contig Information
Length 708 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10d16   
Homology (BLAST) Top Hit putative acyl transferase 3 [Triticum aestivum]
Score 1050
Evalue 1.36901e-112
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok10d16
GGGGTGCCCCGCCATCCGCTGCACCGCCGACGGCGTCTACTTCGCGGAGGCCGTGGCGGAGTGCAGCCTGGAGGACGTGCGGTTCCTGGAGCGCCCCCTG
CTGCTCCCCAAGGAGGACCTCGTCCCCTACCCCGCCGACGATCTCTGGGGCGTCGAACCCCACAACACCATCATGATGATGCAGATCACGAAGTTCACCT
GCGGCGGGTTCGTGATGGGCCTGCGGTTCAACCACGCGTCGGCGGACGGCATGGGCGCGGCGCAGTTCATCAAGGCCGTGGGCGACATGGCGCGGGGGCT
CCCGGAGCCGGCGGTGAAGCCGGTGTGGGACAGGGAGAAGTTCCCCAACCCGAGCATCAAGCCGGGGCCGCTCCCGGAGCTCCCCGTGCTGGCGCTGGAC
TACATCGTGCTCGACTTCCCCACGGGCTACATCGACGCGCTCAAAACGCANTACAAGGCGCACAGCGGCAAGTTCTGCTCCGGCTTCNACNTGCTGACGG
CCAANCTGTGGCANTGCCNCACCCGGGCNCTGAACCTGNANCCCNANGCNACNGTGAANCTCTGCTTCTTCNCCANCNTGCNCCACCTGCTGAANCTGGA
CNCNNNGTACTACNGCAACTCCATCTTCCCCNTNAANATNTCCNNNANCANCAANAANGTGCTGNANTCNTCNNTNATNNANGTNATCNANATNATCCNN
NANNNNAA
page-top