Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10b10
Contig Information
Length 741 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10b10   
Homology (BLAST) Top Hit hypothetical protein OsJ_012340 [Oryza sativa (japonica cultivar-group)]
Score 98
Evalue 0.0372202
Total Hit Count 35
Registered year 2003
Contig Sequence     [ Download ]
>whok10b10
GGCATCAGCAAACGGCCTAAAGCCTACAGCCTAAGCTAGGGTTTTCGATTTGGGGATCGGGACTCGGGAGGCCGCCGCATCCTCTCTCAATCCACGCCAA
TCCCTAGCCACATCTCCGGCCACCTTCCGCCATGTCTTCACCGAGGGAGTTTTCCTGGGTCGTGCTGAGGAAACACGTCCCGGTCTTCGACGCCGAGGAG
AAGGAGCAGGAAGACAAGATCATGGCCAAGGCGAGCAAAGATTGGGGGGACATCGAGAAAGGGTCCTGGATACTGGACCAGTTCTCGCTCGACGCGCACC
TCGTCGAGCCGCCGGAGCTCTCCACCTTGTCCGTGCGCGCCAAGATCGAGACGCAGGAGCGCGGCTTCGGGTGCGTCCTCGACTCCGTCGTGGAGAACTA
CCTCGTCATGACTCTGGTGTTCTGCGACAGGCGGTACGGGCTCGTCTACGACGCCGCCAAGAACTCGCTCTCACTGCTCCCCGCCACCATGGATTCCTTC
GCGGGCTACGACATCGCGTCGAGAGTTGATTCTGTGCCCTTCTTCTTCCTGAGGGAACCTGCTGTCCTGCCACGCGACGACGGTTCCTACGATCTGTTCA
ATCTGGGGTTCCGTTTCGCTACACGCGACAGAGTGTTGCANGGGTCGTCNGGCATCATCTTCCGGTGGTCNAGCCATGCCGCTGGCAANAAGTGGACNAA
NCANGANGCGCGCTTCANCCCGCATACCCANGTGCCGCGCC
page-top