Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whok10b06
Contig Information
Length 780 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
whok10b06   
Homology (BLAST) Top Hit hypothetical protein OsI_34292 [Oryza sativa Indica Group]
Score 752
Evalue 3.05127e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whok10b06
TGGTGTCCCGCGCTGGGTTCGCCTCCCTCCTCGGCGCCTCCTTCCTCCTGCTCCTCCTGCGCGGCGCCGAGCCGCTCGGGTTCAGCCACCGCCCGATGAC
CGCCGGCGACGAGCTCTCGGCCGCCCCGAGCAGATACCTGACGCGGGAGGAGCGCTGGATGAGCCAGCGCCTCGACCACTTCTCCCCCACCGACCACCGC
CAATTCAATCAGCGCTACTTCGAGTTCCTGGACTACCACGACGACCCCACCGGTACTACGGCAAGAGCTCCCCGTTCGACAGCCTCACCACCGACAACCT
CAGGTTCCTGTCGTCCAAGCAGGCGCTCTTCGACCTCGCCGTCTTCCGCCAGTATTACCAGGAAAAACTGAATTCTCAGTACAACCGGAGCGCGGGGTTC
GACAATCCGTGGTTTGTCTTCGGGGTCTCCTACTCCGGGGCTCTCAGCGCCTGGTTCAGGCTCAAGTTCCCTCACCTGACATGCGGAAGCCTCGCGAGCT
CCGGGGTGGTTCTTGCTGTGTACAACTTCACTGATTTCGACAAGCAGGTTGGAGAGTCGGCTGGCCCTCAGTGCAAAGCCGCCCTTCAGGAAATAACTAG
ACTTGTCGACGAACAGCTTCGGTTGGATAGCCACTCTGTGAAGGCCTTGTTCGGAGCAGATTCGTTGAAAAATGACGGCGACTTCCTCTTTCTTCTGGCA
GATGCAGCAGCCACAACATTCCAGTATGGGAATCCTGATGCCTTGTGCTCTCCTCTAGCTAATGGCGAANAAAAAGGGGG
page-top