Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig67
Contig Information
Length 744 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl9h08    rwhfl9h08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.2
Score 473
Evalue 1.23255e-45
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig67
acttctgcaattccccacctcccagcgaaacacctcccgctccctctcccacctccgaAGCAGCAGCAGCAGCCATGGCCCCCAAGgcaagACAAGAAGC
CGGCCGCCGAGAGCAAGGTCGAGAAGGCGGCGGAGAAGACCCCGGcgggc*aAGAAGCCCAAGACCGAGAAGCGGTTTCCGGCGGGCAAGACGGCGGCCA
AGGAGGGCGCCGGCGGCGAGGGCAAGACGAGGGGCCGGAAGAAGGGCGGCAAGGCGAAGAAGGGCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCT
GAAGCAGGTGCACCCGGACATCGGCATCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGGGAGTCAGCC
AAGCTAGCGAGGTACAACAAGAAGCCCACCGTCACCTCCCGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGCGAGCTCGCCAAGCACGCCGTCT
CCGAGGGCACCAAGGCCGTCACCAAGTTCACCTCCTCCTAGACTGAATCTGAATGCGTCGCCTTGTTGTtccaaatgtagtactagttggctgctgttga
ctctgcctgtctctctgcgagtagtggtagtggtagatgattgccaacgcttcgttggctccttggttgttagaggtgaacttgttgcttttgcaaactg
atatcactatctagaaaatgttgcagtcgtggttccatatccgt
page-top