Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whms12l10
Contig Information
Length 216 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
whms12l10   
Homology (BLAST) Top Hit casein kinase II beta [Hordeum vulgare]
Score 148
Evalue 3.8811e-15
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>whms12l10
ACCGGGGATTCGGCGGCGCCGCGGAGATGGACCGGAAGCGCATCAAGGAGGCGCTCGAGAAGCACACGGAGAGGCCGTCCCCGCTCCACCTCCNGGGGGG
CGTCCAGGGANAAGGAGCTGCTCGCCGCCGGCAAGATAACCACTCAGATCGGCAAGGTCCCCATGGTCTCCNACGTCGAGGAATTCCAAACTGACAGTGA
AGATTCTGATGTTANT
page-top