Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig664
Contig Information
Length 735 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 3 Clones [Download: CSV  ,  FASTA ]
rwhfl10d10    rwhfl10d21    whfl10d10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_01178 [Oryza sativa Indica Group]
Score 495
Evalue 3.37581e-48
Total Hit Count 84
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig664
aatggtccagtctataatgggcacatagcaaggtagctgttcgatgaagtACAAACCCGcagccgCAGTCCTTGAAATTACAACCGTCTCTTTTCTTATC
TATGGACGCAAGCATACATCCCTTCCCTGcggtccaCAGACAATGAAAgcaagCTGCTTCTTTAGACGACGAGGCCCCTTCTCACCGACAACACGAGATT
CCACGCTGTTGATCAGTTGATATTCATGTCCTCCGacccagCGCCATCTCCATCCTCGTTTTCGGATGAActgtagatagagctccttgaacgctgttgc
tgttgtcgtgtgggctgcaactttggcctgagtgcctcgagcggtcctttgggttttgcaacaccttgctgtccagactttccgagagcccaatcagcag
agtcaaaataggcccgctcgtgatcctttgagatgagcggtGGCTTTTTAGGAATTAGTCCTCCAAACTTCTTCTTGATTACTTGTTCCTGTTGCTGAGC
CGATGGCATGGCATTATCTCCACTTTGGTCCATAGGTTCAGAATTTCCAACATTATCATGCCCAGCAGCATTGGCGTCCTTCATCCCCGACATGGTGGGT
TACGGTCACGGAGACGCTGGCGGCGAGGgaggcGTCGGCTCGGCTGCTCCGaggtggagaaatggggaaccgagggagggccggcgagcagcagcggctc
tccaatgagtggaggtatgtttgtttgttggctgc
page-top