Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig929
Contig Information
Length 600 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10b21    rwhdp10b21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0446300 [Oryza sativa (japonica cultivar-group)] >gi|38344552|emb|CAD40959.2| OSJNBa0027P08.20 [Oryza sativa (japonica cultivar-group)] >gi|113564480|dbj|BAF14823.1| Os04g0446300 [Oryza sativa (japonica cultivar-group)] >gi|116310237|emb|CAH67246.1| OSIGBa0140O07.14 [Oryza sativa (indica cultivar-group)] >gi|215701241|dbj|BAG92665.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704444|dbj|BAG93878.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765538|dbj|BAG87235.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218194933|gb|EEC77360.1| hypothetical protein OsI_16063 [Oryza sativa Indica Group]
Score 721
Evalue 1.35676e-74
Total Hit Count 97
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig929
GGCAAGGGCTATGTGGAGAACACGCGGCTGGGCAACTGGAAGCTCCTGATCGGGACGGCCGTGATCGCCATCGCGCTCCTCGCGCAGTTCTACCCGAAGA
AGTTCCCGCAGAACCGCGAGTTCCTGCTCGGTTGCATCGCGCTGTATGTGGTGATGAATGTGGTGCTACTGATCCTTAGCTACACCAAGGAAAAGGATGC
CATCATCTTCACCCACCCTCCTGCTGGTTCTTTCAATAACACTGGCCTTGTTATATCTTCAAAGTTGCCAAGATTCTTGGACATGTACAATCTTTCAATA
GCCAGCGCGGATCCAGAATCTATCTCTGCTCACAAGCCTGTCCACTTCACTAAGAGTGTTACAAAATGGTTTACAAAGGAAGGTGTTCTTGTGGAGGGCC
TGTTCTGGAAGGATGTTGAGAGACTGATTGATGACTACAACAACGAGCGCAAGAGCAAATGAATTACTAGCCCTTGTCATCATTATCAGGATGAAGCTTA
GCCTAATCGAAATAGACAATGTTTTTGATAGCAGTACTGTTTGAACTGGTGAATGAAGCACCATTAAGATAATACATCATTGCAGTCTTTTTTCTTGGTA
page-top