Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhms10f21
Contig Information
Length 141 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhms10f21   
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 127
Evalue 5.55019e-06
Total Hit Count 477
Registered year 2003
Contig Sequence     [ Download ]
>rwhms10f21
TCCTGATCTGTGTGCGGTGGCTCTGGAACCANGATCTGACCTGCTTGGTCTCCAGAACAAGCTCGCGTCCAAGCTGANCGCACTCGATCTCACTGGGGTG
ATCGGACTTCTTGTACGACTCCTCCAACTTCTGGACCTGCT
page-top